SomamiR DB 2.0
Somatic mutations altering microRNA-ceRNA interactions
  Home Search Help Download  


Browse somatic mutations in miRNA sequences

 
OR
Include ALL


Total 2423 records current page of 122 records per page
 
 
 
      next page
[download data table]
*Clicking the link in the last column will send miRNA seed mutation data to miR2GO for functional analysis.
microRNA ID Mutation Mutation ID Region miR_Mutation
Location
Sample Name Cancer Type
[Tissue][Sub tissue][Histology][Sub histology]
Functional analysis
of the somatic mutation
with miR2GO
hsa-miR-9-5p chr15:g.89368033C>G COSN2379608 Seed 2 TCGA-67-3771-01 [lung][NS][carcinoma][adenocarcinoma] U[C/G]UUUGGUUAUCUAGCUGUAUGA
hsa-miR-99a-5p chr21:g.16539106G>A COSN7106101 Seed 6 8035755 [pancreas][NS][carcinoma][NS] AACCC[G/A]UAGAUCCGAUCUUGUG
hsa-miR-1307-5p chr10:g.103394357G>C COSN1467510 Seed 5 RK051_C01 [liver][NS][carcinoma][NS] UCGA[C/G]CGGACCUCGACCGGCU
hsa-miR-3142 chr5:g.160474455CT>- COSN1310486 Seed 6 HCC84T [liver][NS][carcinoma][NS] No miR2GO Data
hsa-miR-516a-5p chr19:g.53761153G>A COSN522780 Seed 6 TCGA-BH-A0DZ-01 [breast][NS][carcinoma][NS] UUCUC[G/A]AGGAAAGAAGCACUUUC
hsa-miR-1307-3p chr10:g.103394319G>T COSN2378364 Seed 4 TCGA-33-4582-01 [lung][NS][carcinoma][squamous_cell_carcinoma] ACU[C/A]GGCGUGGCGUCGGUCGUG
hsa-miR-518e-5p chr19:g.53729858G>T COSN2378632 Seed 6 TCGA-34-2608-01 [lung][NS][carcinoma][squamous_cell_carcinoma] CUCUA[G/U]AGGGAAGCGCUUUCUG
hsa-miR-299-5p chr14:g.101023802G>A COSN2377168 Seed 3 TCGA-CZ-5466-01 [kidney][NS][carcinoma][clear_cell_renal_cell_carcinoma] UG[G/A]UUUACCGUCCCACAUACAU
hsa-miR-520d-3p chr19:g.53720152G>T COSN8975814 Seed 4 AOCS-120-3-6 [ovary][NS][other][neoplasm] AAA[G/U]UGCUUCUCUUUGGUGGGU
hsa-miR-611 chr11:g.61792520C>T COSN8309427 Seed 3 TCGA-D8-A1JA-01 [breast][NS][carcinoma][NS] GC[G/A]AGGACCCCUCGGGGUCUGAC
hsa-miR-192-5p chr11:g.64891218G>A COSN7016909 Seed 6 8047575 [pancreas][NS][carcinoma][NS] CUGAC[C/U]UAUGAAUUGACAGCC
hsa-miR-518b chr19:g.53702793G>T COSN8606333 Seed 7 J87_T [lung][NS][carcinoma][squamous_cell_carcinoma] CAAAGC[G/U]CUCCCCUUUAGAGGU
hsa-miR-548i chr3:g.125790508T>C COSN5028976 Seed 7 TCGA-EE-A2MD-06 [skin][NS][malignant_melanoma][NS] AAAAGU[A/G]AUUGCGGAUUUUGCC
hsa-miR-518a-3p chr19:g.53731061C>T COSN1082482 Seed 6 TCGA-BS-A0UV-01 [endometrium][NS][carcinoma][endometrioid_carcinoma] GAAAG[C/U]GCUUCCCUUUGCUGGA
hsa-miR-299-3p chr14:g.101023835G>T COSN526471 Seed 4 TCGA-69-7980-01 [lung][right_upper_lobe][carcinoma][adenocarcinoma] UAU[G/U]UGGGAUGGUAAACCGCUU
hsa-miR-3142 chr5:g.160474455CT>- COSN1310485 Seed 6 HCC52T [liver][NS][carcinoma][NS] No miR2GO Data
hsa-miR-4458 chr5:g.8460934G>T COSN9194024 Seed 2 AOCS-119-3-9 [ovary][NS][other][neoplasm] A[G/U]AGGUAGGUGUGGAAGAA
hsa-miR-3591-3p chr18:g.58451105G>T COSN5847013 Seed 4 HCC106 [liver][NS][carcinoma][NS] AAA[C/A]ACCAUUGUCACACUCCAC
hsa-miR-1307-5p chr10:g.103394357G>C COSN1467509 Seed 5 RK051_C01 [liver][NS][carcinoma][NS] UCGA[C/G]CGGACCUCGACCGGCU
hsa-miR-548i chr4:g.9556275T>G COSN523718 Seed 4 TCGA-BH-A0AW-01 [breast][NS][carcinoma][NS] AAA[A/C]GUAAUUGCGGAUUUUGCC