SomamiR DB 2.0 Somatic mutations altering microRNA-ceRNA interactions |
||||||||
Home | Search | Help | Download |
Browse somatic mutations in miRNA sequences |
---|
OR |
Include ALL |
[download data table] | ||
*Clicking the link in the last column will send miRNA seed mutation data to miR2GO for functional analysis. |
microRNA ID | Mutation | Mutation ID | Region | miR_Mutation Location |
Sample Name | Cancer Type [Tissue][Sub tissue][Histology][Sub histology] |
Functional analysis of the somatic mutation with miR2GO |
||
---|---|---|---|---|---|---|---|---|---|
hsa-miR-302d-5p | chr4:g.112648064A>G | COSN2378830 | Seed | 3 | TCGA-66-2744-01 | [lung][NS][carcinoma][squamous_cell_carcinoma] | AC[U/C]UUAACAUGGAGGCACUUGC | ||
hsa-miR-519a-3p | chr19:g.53752452G>T | COSN2379827 | Seed | 4 | TCGA-50-5049-01 | [lung][NS][carcinoma][adenocarcinoma] | AAA[G/U]UGCAUCCUUUUAGAGUGU | ||
hsa-miR-519d-3p | chr19:g.53713406G>A | COSN2382203 | Seed | 7 | TCGA-BS-A0U8-01 | [endometrium][NS][carcinoma][endometrioid_carcinoma] | CAAAGU[G/A]CCUCCCUUUAGAGUG | ||
hsa-miR-637 | chr19:g.3961447C>T | COSN1082357 | Seed | 6 | TCGA-AP-A0LM-01 | [endometrium][NS][carcinoma][endometrioid_carcinoma] | ACUGG[G/A]GGCUUUCGGGCUCUGCGU | ||
hsa-let-7g-5p | chr3:g.52268353C>A | COSN1278471 | Seed | 5 | BN41T | [liver][NS][carcinoma][NS] | UGAG[G/U]UAGUAGUUUGUACAGUU | ||
hsa-miR-146a-5p | chr5:g.160485375G>T | COSN1083746 | Seed | 4 | TCGA-D1-A16X-01 | [endometrium][NS][carcinoma][endometrioid_carcinoma] | UGA[G/U]AACUGAAUUCCAUGGGUU | ||
hsa-miR-616-3p | chr12:g.57519201G>T | COSN1080682 | Seed | 4 | TCGA-B5-A0JY-01 | [endometrium][NS][carcinoma][endometrioid_carcinoma] | AGU[C/A]AUUGGAGGGUUUGAGCAG | ||
hsa-miR-518a-3p | chr19:g.53731059A>T | COSN5028208 | Seed | 4 | TCGA-EE-A181-06 | [skin][NS][malignant_melanoma][NS] | GAA[A/U]GCGCUUCCCUUUGCUGGA | ||
hsa-miR-518c-3p | chr19:g.53708799A>C | COSN1082495 | Seed | 4 | TCGA-BS-A0UV-01 | [endometrium][NS][carcinoma][endometrioid_carcinoma] | CAA[A/C]GCGCUUCUCUUUAGAGUGU | ||
hsa-miR-155-3p | chr21:g.25574024C>A | COSN6561809 | Seed | 3 | ICGC_MB102 | [central_nervous_system][brain][primitive_neuroectodermal_tumour-medulloblastoma][NS] | CU[C/A]CUACAUAUUAGCAUUAACA | ||
hsa-miR-371a-3p | chr19:g.53787721C>A | COSN5761935 | Seed | 6 | HCC153 | [liver][NS][carcinoma][NS] | AAGUG[C/A]CGCCAUCUUUUGAGUGU | ||
hsa-miR-4454 | chr4:g.163093620C>T | COSN7748293 | Seed | 7 | 8068548 | [pancreas][NS][carcinoma][NS] | GGAUCC[G/A]AGUCACGGCACCA | ||
hsa-miR-1246 | chr2:g.176601038C>T | COSN5028749 | Seed | 5 | TCGA-D3-A3CB-06 | [skin][NS][malignant_melanoma][NS] | AAUG[G/A]AUUUUUGGAGCAGG | ||
hsa-miR-376c-5p | chr14:g.101039698G>T | COSN2380759 | Seed | 5 | TCGA-CH-5761-01 | [prostate][NS][carcinoma][adenocarcinoma] | GGUG[G/U]AUAUUCCUUCUAUGUU | ||
hsa-miR-302f | chr18:g.30298941G>T | COSN5844593 | Seed | 6 | HCC113 | [liver][NS][carcinoma][NS] | UAAUU[G/U]CUUCCAUGUUU | ||
hsa-miR-3622a-5p | chr8:g.27701696C>T | COSN8078867 | Seed | 7 | 8058339 | [pancreas][NS][carcinoma][NS] | CAGGCA[C/U]GGGAGCUCAGGUGAG | ||
hsa-miR-409-3p | chr14:g.101065350G>A | COSN5746082 | Seed | 5 | HCC80T | [liver][NS][carcinoma][NS] | GAAU[G/A]UUGCUCGGUGAACCCCU | ||
hsa-miR-1252-5p | chr12:g.79419265G>A | COSN1587082 | Seed | 5 | RK100_C01 | [liver][NS][carcinoma][NS] | AGAA[G/A]GAAAUUGAAUUCAUUUA | ||
hsa-miR-1243 | chr4:g.113106872G>T | COSN2378829 | Seed | 6 | TCGA-34-5927-01 | [lung][NS][carcinoma][squamous_cell_carcinoma] | AACUG[G/U]AUCAAUUAUAGGAGUG | ||
hsa-miR-9-5p | chr15:g.89368033C>G | COSN2379608 | Seed | 2 | TCGA-67-3771-01 | [lung][NS][carcinoma][adenocarcinoma] | U[C/G]UUUGGUUAUCUAGCUGUAUGA |