SomamiR DB 2.0 Somatic mutations altering microRNA-ceRNA interactions
	Home	Search	Help	Download

Prediction criteria:	TargetScan sites only     All 6mer or longer seed matches

RefSeq ID:	NM_001203
Gene Symbol:	BMPR1B
Description:	Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), mRNA.
Gene Location:	chr4(+):95679127-96079601
Browse Associations
Browse Pathways

Somatic mutations that impact miRNA target sites

Mutation			Mutation ID		Sample Name		Cancer Type
chr4:g.95154776A>C			COSN5581044		RK155_C01		[liver][NS][carcinoma][NS]
miRNA Targets Table
miR ID	miRSite	Conservation	miRSeed	SeedClass	FuncClass	Wildtype CS+	Mutant CS+	PITA score change
hsa-miR-3922-5p	caaGCCTTGAacatcgtcc	32767	UCAAGGCC	m7a	(m7a->m6a)	-0.154000	-0.002000	0.460000
hsa-miR-4708-3p	caaGCCTTGCacatcgtcc	32767	AGCAAGGC	m7b	(m6b->m7b)	no TS	-0.457000	-7.330000
hsa-miR-561-5p	caagCCTTGAacatcgtcc	32767	AUCAAGGA	m6b	Disrupted	-0.165000	-0.054000	4.580000

Mutation			Mutation ID		Sample Name		Cancer Type
chr4:g.95154818G>T			0_186				Lung cancer
miRNA Targets Table
miR ID	miRSite	Conservation	miRSeed	SeedClass	FuncClass	Wildtype CS+	Mutant CS+	PITA score change
hsa-miR-125a-5p	cacctCTCAGGGAgcgacc	19	UCCCUGAG	m8a	Disrupted	-0.326	no TS	No effect
hsa-miR-125b-5p	cacctCTCAGGGAgcgacc	19	UCCCUGAG	m8a	Disrupted	-0.326	no TS	No effect
hsa-miR-345-3p	cacctcTCAGGGagcgacc	20	GCCCUGAA	m6b	Disrupted	-0.13	no TS	6.5
hsa-miR-4319	cacctCTCAGGGAgcgacc	19	UCCCUGAG	m8a	Disrupted	-0.326	no TS	0.03
hsa-miR-4324	caccTCTCAGGGagcgacc	18	CCCUGAGA	m8a	Disrupted	-0.076	no TS	No effect
hsa-miR-4712-3p	cacCTCTCATggagcgacc	19	AAUGAGAG	m7b	(m6b->m7b)	-0.099	-0.162	No effect
hsa-miR-4732-3p	cacctcTCAGGGagcgacc	20	GCCCUGAC	m6b	Disrupted	-0.117	no TS	-2.37
hsa-miR-670	cacctcTCAGGGAgcgacc	20	GUCCCUGA	m7b	Disrupted	-0.253	-0.155	0.07

Mutation			Mutation ID		Sample Name		Cancer Type
chr4:g.95155206T>G			COSN7849199		8035603		[pancreas][NS][carcinoma][NS]
miRNA Targets Table
miR ID	miRSite	Conservation	miRSeed	SeedClass	FuncClass	Wildtype CS+	Mutant CS+	PITA score change
hsa-miR-4717-5p	caccccgtcGTGGCCTcct	32767	UAGGCCAC	m7b	(m6c->m7b)	-0.152000	-0.245000	-0.570000
hsa-miR-483-5p	cacCCCGTCTTggcctcct	32767	AAGACGGG	m8a	Disrupted	-0.145000	no TS	5.400000

Mutation			Mutation ID		Sample Name		Cancer Type
chr4:g.95155750A>G			COSN5581045		RK145_C01		[liver][NS][carcinoma][NS]
miRNA Targets Table
miR ID	miRSite	Conservation	miRSeed	SeedClass	FuncClass	Wildtype CS+	Mutant CS+	PITA score change
hsa-miR-624-3p	gcatACCTTGTtttgtaca	32767	CACAAGGU	m7b	Created	-0.034000	-0.130000	-0.170000

Mutation			Mutation ID		Sample Name		Cancer Type
chr4:g.95156054T>C			COSN2051995		RK208_C01		[liver][NS][carcinoma][NS]
miRNA Targets Table
miR ID	miRSite	Conservation	miRSeed	SeedClass	FuncClass	Wildtype CS+	Mutant CS+	PITA score change
hsa-miR-3121-3p	ttcaCTATTTAatttatta	32767	UAAAUAGA	m7a	Disrupted	0.103000	no TS	-0.030000
hsa-miR-5585-3p	ttcaCTATTCAatttatta	32767	CUGAAUAG	m7b	Created	no TS	-0.001000	-0.030000

Mutation			Mutation ID		Sample Name		Cancer Type
chr4:g.95156132T>C			COSN2051996		RK020_C01		[liver][NS][carcinoma][NS]
miRNA Targets Table
miR ID	miRSite	Conservation	miRSeed	SeedClass	FuncClass	Wildtype CS+	Mutant CS+	PITA score change
hsa-miR-4670-3p	tttTAACTTCggagcaaca	32767	UGAAGUUA	m7b	(m6b->m7b)	0.105000	0.177000	No effect
hsa-miR-4671-5p	ttttaaCTTCGGagcaaca	32767	ACCGAAGA	m6b	Created	no TS	-0.072000	-5.100000
hsa-miR-548at-5p	tttTAACTTTggagcaaca	32767	AAAAGUUA	m7b	(m7b->m6b)	0.268000	0.131000	0.010000
hsa-miR-4670-3p	tttTAACTTCggagcaaca	0	UGAAGUUA	m7b	(m6b->m7b)	0.105	0.177	No effect
hsa-miR-4671-5p	ttttaaCTTCGGagcaaca	0	ACCGAAGA	m6b	Created	no TS	-0.072	-5.1
hsa-miR-548at-5p	tttTAACTTTggagcaaca	0	AAAAGUUA	m7b	(m7b->m6b)	0.268	0.131	0.01

Mutation			Mutation ID		Sample Name		Cancer Type
chr4:g.95157022A>G			6_2240		CLL3		Chronic lymphocytic leukaemia
miRNA Targets Table
miR ID	miRSite	Conservation	miRSeed	SeedClass	FuncClass	Wildtype CS+	Mutant CS+	PITA score change
hsa-miR-1297	aaTACTTGAAcgtggataa	6	UUCAAGUA	m8a	(m8a->m7a)	-0.033	-0.044	0.12
hsa-miR-26a-5p	aaTACTTGAAcgtggataa	6	UUCAAGUA	m8a	(m8a->m7a)	-0.05	-0.06	0.31
hsa-miR-26b-5p	aaTACTTGAAcgtggataa	6	UUCAAGUA	m8a	(m8a->m7a)	-0.04	-0.051	0.04
hsa-miR-4465	aaTACTTGAGcgtggataa	6	CUCAAGUA	m8a	(m7a->m8a)	-0.089	-0.095	0.13
hsa-miR-574-3p	aatactTGAGCGTGgataa	5	CACGCUCA	m8a	Created	no TS	-0.154	-3.18
hsa-miR-1297	aaTACTTGAAcgtggataa	32767	UUCAAGUA	m8a	(m8a->m7a)	-0.033000	-0.044000	0.120000
hsa-miR-26a-5p	aaTACTTGAAcgtggataa	32767	UUCAAGUA	m8a	(m8a->m7a)	-0.050000	-0.060000	0.310000
hsa-miR-26b-5p	aaTACTTGAAcgtggataa	32767	UUCAAGUA	m8a	(m8a->m7a)	-0.040000	-0.051000	0.040000
hsa-miR-4465	aaTACTTGAGcgtggataa	32767	CUCAAGUA	m8a	(m7a->m8a)	-0.089000	-0.095000	0.130000
hsa-miR-574-3p	aatactTGAGCGTGgataa	0	CACGCUCA	m8a	Created	no TS	-0.154000	-3.180000

*By default, only target sites identified by TargetScan are displayed. To display all potentially impacted target sites, select "All 6mer or longer seed matches" above.

Germline mutations in target sites of miRNAs in somatic mutation table

Location	SNP ID	Ancestral Allele	Allele	miR ID	Conservation	miRSite	FuncClass	Validation	context+ score change
95154814	rs1434536	C	C	hsa-miR-125a-5p hsa-miR-125b-5p hsa-miR-4319 hsa-miR-4324 hsa-miR-6761-5p hsa-miR-7854-3p	0	tcacctCTCAGGG tcacctCTCAGGG tcacctCTCAGGG tcaccTCTCAGGg tcacCTCTCAGgg TCACCTCtcaggg	Disrupted Disrupted Disrupted Disrupted Disrupted Disrupted	N N N N N N	-0.219 -0.219 -0.219 -0.076 -0.065 -0.114
			T	hsa-miR-345-3p hsa-miR-4766-5p hsa-miR-488-3p hsa-miR-5681a hsa-miR-6730-5p	0	tcacctTTCAGGG tcacCTTTCAGgg tcaCCTTTCAggg tcaCCTTTCAggg tcACCTTTCAggg	Created Created Created Created Created	N N N N N	-0.208 -0.003 -0.082 -0.024 -0.181
95155548	rs111971137	-	ATTCAAAGGATCAATATTAAAT	hsa-miR-4712-3p	0	ttgacctgtgcatgcttttgatCTCTCATtcaaaggatcaatattaaataaaatt	Unknown	N	-0.099
			-	hsa-miR-8055	0	ttgacctgtgcatgcttttgatctCTCAAAAtt	Unknown	N	0.022
95156644	rs191224787	C	C	hsa-miR-3159 hsa-miR-541-5p hsa-miR-561-5p hsa-miR-6830-5p	0	cgTAATCCTtgaa cgtAATCCTTgaa cgtaaTCCTTGAA cgtaaTCCTTGAa	Disrupted Disrupted Disrupted Disrupted	N N N N	0.032 0.008 -0.096 0.002
			G	hsa-miR-498	0	cgtaatGCTTGAA	Created	N	-0.077
95156645	rs185854880	C	C	hsa-miR-3159 hsa-miR-498 hsa-miR-541-5p hsa-miR-561-5p hsa-miR-6830-5p	0	gTAATCCTtgaaa gtaatcCTTGAAA gtAATCCTTgaaa gtaaTCCTTGAAa gtaaTCCTTGAaa	Disrupted Disrupted Disrupted Disrupted Disrupted	N N N N N	0.032 0.058 0.008 -0.096 0.002
			A	hsa-miR-580-5p	0	gtAATCATTgaaa	Created	N	0.08
95157005	rs73839218	T
			A	hsa-miR-3121-3p	0	tttTCTATTTggt	Created	N	0.081

Genome Browser